Journal: Cell reports

Article Title: RGS6 mediates effects of voluntary running on adult hippocampal neurogenesis

doi: 10.1016/j.celrep.2020.107997

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit anti-RGS6 antibodies-online Inc #ABIN634403 Mouse anti-HA.11 Biolegend # MMS-101R Rabbit anti-MCM2 Cell Signaling Technology #4007 Goat anti-DCX Santa Cruz Biotechnology # SC-8066 Rabbit anti-GFAP DAKO #Z0334 Rabbit anti-NeuN Cell Signaling Technology #4007 Rabbit anti-DsRed Takara #632496 Donkey anti-mouse 488 Invitrogen A21202 Donkey anti-mouse 568 Invitrogen A10037 Donkey anti-rabbit 488 Invitrogen A21206 Donkey anti-rabbit 647 Invitrogen {"type":"entrez-protein","attrs":{"text":"A31573","term_id":"87384","term_text":"pir||A31573"}} A31573 Donkey anti-goat 568 Invitrogen A11057 Goat anti-mouse 488 Invitrogen A11029 Goat anti-rabbit 568 Invitrogen A11036 Goat anti-rabbit 568 Invitrogen A11011 Bacterial and Virus Strains Lentivirus-STOP-RGS6-GFP This paper N/A Lentivirus-STOP-GFP This paper N/A Retrovirus- shRgs6 -GFP This paper N/A Retrovirus- shNC -GFP ( Guo et al., 2015 ) N/A Deposited Data Source data associated with RiboTag sequencing This paper GEO: {"type":"entrez-geo","attrs":{"text":"GSE142678","term_id":"142678"}} GSE142678 Experimental Models: Organisms/Strains Mouse: C57BL/6J Jackson Laboratory RRID:IMSR_JAX:000664 Mouse: Tg(Nestin-cre/ERT2) Jackson Laboratory RRID:IMSR_JAX:016261 Mouse: RPL22 HA/WT Jackson Laboratory RRID:IMSR_JAX:029977 Mouse: Ascl1tm1(Cre/ERT2)Jejo/J Jackson Laboratory RRID:IMSR_JAX:012882 Mouse: B6;129S6-Gt(ROSA)26Sortm14(CAG-tdTomato)Hze/J Jackson Laboratory RRID:IMSR_JAX:007914 Mouse: Nestin-GFP Yamaguchi et al., 2000 ) ( Yamaguchi et al., 2000 ) Oligonucleotides Rgs6 Forward: GGATCGCTGATCCAGAAGAG This study N/A Rgs6 Reverse: GGGGATTTTGGAGAGAAAGC This study N/A Pgk1Forward: CTCCGCTTTCATGTAGAGGAAG This study N/A Pgk1Reverse: GACATCTCCTAGTTTGGACAGTG This study N/A Recombinant DNA Retro-CAG-GFP-shRgs6 This study N/A Retro-shNC ( Gao et al., 2015 ) N/A Retro-CAG-RFP ( Zhao et al., 2006 ) N/A Lenti-GFP-Control This study N/A Lenti-GFP-RGS6 This study N/A Software and Algorithms Prism GraphPad https://www.graphpad.com ; RRID:SCR_002798 ImageJ National Institute of Health https://imagej.nih.gov/ij/docs/guide/user-guide.pdf ANYmaze Stoelting https://www.stoeltingco.com/anymaze.html RStudio https://rstudio.com/ WGCNA ( Langfelder and Horvath, 2008 ) g:Profiler https://biit.cs.ut.ee/gprofiler/gost Monocle ( Trapnell et al., 2014 ) Open in a separate window KEY RESOURCES TABLE

Techniques: Virus, Sequencing, Recombinant, Software

Journal: Nature Communications

Article Title: Memory strength gates the involvement of a CREB-dependent cortical fear engram in remote memory

doi: 10.1038/s41467-019-10266-1

Figure Lengend Snippet: Viral-TRAP enables inducible activity-dependent tagging of mPFC neurons. a Schematic representation of the viral-TRAP method. A mixture of AAV-Fos::CreER T2 and Cre-dependent AAV (e.g. AAV-hSyn::DIO-hM4Di-mCherry) is bilaterally infused into the mPFC. The Fos promoter is activated by neuronal activity, resulting in CreER T2 expression. Systemic injection of 4-hydroxytamoxifen (4TM) allows translocation of CreER T2 into the nucleus enabling irreversible recombination of the Cre-dependent vector and expression of hM4Di-mCherry driven by the human Synapsin (hSyn) promoter. fmi = forceps minor of the corpus callosum. b Experimental design of groups used to validate viral-TRAP. Home-cage (HC) −4TM ( n = 4), HC + 4TM ( n = 7), Contextual fear conditioning (CFC) + 4TM ( n = 6). 4TM was injected systemically 2 h after CFC on day 0 and all groups were killed 4 days later. c Expression of hM4Di-mCherry in mPFC. fmi = forceps minor of the corpus callosum. ML = midline. Left: scale bar = 250 µm; Right: scale bar = 100 µm. d Percentage of hM4Di-mCherry + cells in mPFC. One-way ANOVA: F (2,14) = 12.3, p = 0.001; post-hoc Bonferroni test: CFC vs. HC −4TM, p = 0.001, CFC vs. HC + 4TM, * p = 0.007. e Patch-clamp recordings of hM4Di + and mCherry + (control) cells before and after CNO application. ACSF = artificial cerebrospinal fluid. f Resting membrane potential changes for mCherry + ( n = 5) and hM4Di + ( n = 7) neurons. Wilcoxon signed rank test, hM4Di + : Z = −2.37, * p = 0.018; mCherry + : Z = −0.41 p = 0.69. g Rheobase changes for mCherry + ( n = 5) and hM4Di + ( n = 7) neurons. Wilcoxon signed rank test, hM4DI + : Z = −2.38 *p = 0.018; mCherry + : Z = −1.63, p = 0.10. All bar graphs show means + s.e.m. Source data are provided as a Source Data file

Article Snippet: The pAAV-Fos::CreER T2 plasmid was generated by replacing the coding sequence of tTA in pAAV-cFos−tTA-pA (gift from William Wisden, Addgene plasmid #66794) with the coding sequence of CreER T2 from pRetroQ-Cre-ERT2 (gift from Richard Youle, Addgene plasmid #59701) using SLiCE .

Techniques: Activity Assay, Expressing, Injection, Translocation Assay, Plasmid Preparation, Patch Clamp, Control, Membrane

Journal: Nature Communications

Article Title: Memory strength gates the involvement of a CREB-dependent cortical fear engram in remote memory

doi: 10.1038/s41467-019-10266-1

Figure Lengend Snippet: Disruption of CREB function in mPFC engram cells impairs remote fear memory. a Mice received AAV-Fos::CreER T2 combined with AAV-hSyn::DIO-EGFP-mCREB into the mPFC. b Representative expression of EGFP-mCREB in mPFC in mice that remained in their home-cage (HC −4TM) and mice that underwent CFC without and with 4TM treatment. Mice were killed 4 days later. Scale bar = 100 µm. fmi = forceps minor of the corpus callosum. ML = midline. c Experimental design. mPFC neurons activated during CFC were tagged with EGFP-mCREB and memory was assessed on day 4 and 30 in the conditioning context. d On day 4, freezing did not differ between mCREB and control mice. Unpaired t -test: t 13 = 0.159, p = 0.876. mCherry ( n = 8), mCREB ( n = 7). e Freezing was significantly reduced in the mCREB mice compared with control mice. Unpaired t -test: t 13 = 2.669, * p = 0.019. mCherry ( n = 7), mCREB ( n = 8). All bar graphs show means + s.e.m. Source data are provided as a Source Data file

Article Snippet: The pAAV-Fos::CreER T2 plasmid was generated by replacing the coding sequence of tTA in pAAV-cFos−tTA-pA (gift from William Wisden, Addgene plasmid #66794) with the coding sequence of CreER T2 from pRetroQ-Cre-ERT2 (gift from Richard Youle, Addgene plasmid #59701) using SLiCE .

Techniques: Disruption, Expressing, Control

Journal: Frontiers in Microbiology

Article Title: Rescue of Recombinant Adenoviruses by CRISPR/Cas-Mediated in vivo Terminal Resolution

doi: 10.3389/fmicb.2022.854690

Figure Lengend Snippet: (A) Shown is the fold increase in the mean fluorescent intensity (MFI) in Flag-tag-specific FACS measurements of different 293A-Cas9 clones expressing Flag-tagged Cas9 compared to the parental 293A signal. Data shown represent the mean of two independent experiments, with error bars indicating the range of measurements. All presented clones were also checked for CTR competency of rAd rescue by co-transfecting of pBWH-C5-mChe and pAR-gRNA-Ex. Clones that appeared to be permissive for rAd rescue based on two experiments are indicated by orange bars, while the white bars indicate clones, which appeared to be non-permissive in at least one experiment. (B) Comparison of different approaches for supplying necessary components for CRISPR/Cas9-mediated CTR. Co-transfection of helper plasmid(s) (Helper) expressing sgRNA and Cas9 protein with the construct carrying the ACT flanked rAd bacmids (rAd, red bar, this approach was applied for most of the experiments described in the manuscript) was compared to combination of all CTR components in one construct coding for the rAd genome and all necessary CRISPR/Cas9-components in the vector backbone (purple bar); the Cas9 is delivered by constitutive expression in the cell line B2 or b5 [see (A) ] used to rescue the rAd, while a bacmid coding for a rAd genome is co-transfected together with a sgRNA-expressing plasmid as in panel (A) (dark and light orange bars); and the same as in previously, but sgRNA is expressed from the same construct that carries the rAd (dark and light gray bars). The primary rescue efficiencies were obtained as in . Significance was calculated using Welch’s ANOVA test.

Article Snippet: The expression cassette coding for the destabilized, human codon-optimized Cas9 fusion protein (DD-Cas9) was constructed on the basis of pDD-Cas9 [Addgene Plasmid #90086, a kind gift from Raffaella Sordella ( )] by inserting a glutamine codon instead of the first methionine codon of the Cas9 coding sequence.

Techniques: FLAG-tag, Clone Assay, Expressing, CRISPR, Cotransfection, Plasmid Preparation, Construct, Transfection

Journal: Frontiers in Microbiology

Article Title: Rescue of Recombinant Adenoviruses by CRISPR/Cas-Mediated in vivo Terminal Resolution

doi: 10.3389/fmicb.2022.854690

Figure Lengend Snippet: ITR-near CRISPR-Cas-mediated cleavage increased the efficient of recombinant adenoviruses rescue. (A) Another sgRNA (sgRNA-Int5, purple, PAM underlined) targeting the ITRs (bold) can induce Cas9-mediated cleavage at the ITRs (purple triangles). To check the impact of cleavage distance, the ITRs were extended by CRISPR/Cas9 target sequences ( ACT , red) using a 12-bp long spacer (black underlined), which was targeted by sgRNA-Ex (red, PAM is underlined) inducing double-strand breaks (red triangles) 18–19 bp upstream of the ITRs. (B) rAd reconstitution efficiencies were compared after co-transfection of 293A cells with pBWH-C5-mChe and pSG5-Cas9F in the presence of either sgRNA-Int5 (Ad5-Int5) or sgRNA-Ex (Ad5-Ex), and with pBWH18/19-C5-mChe in the presence of sgRNA-Ex (Ad518/19-Ex). The primary rescue efficiencies were obtained as in . Significance was calculated using Welch ANOVA test. **** p < 0.0001.

Article Snippet: The expression cassette coding for the destabilized, human codon-optimized Cas9 fusion protein (DD-Cas9) was constructed on the basis of pDD-Cas9 [Addgene Plasmid #90086, a kind gift from Raffaella Sordella ( )] by inserting a glutamine codon instead of the first methionine codon of the Cas9 coding sequence.

Techniques: CRISPR, Recombinant, Cotransfection

Journal: Frontiers in Microbiology

Article Title: Rescue of Recombinant Adenoviruses by CRISPR/Cas-Mediated in vivo Terminal Resolution

doi: 10.3389/fmicb.2022.854690

Figure Lengend Snippet: ITR-near CTR induced also efficient rescue of recombinant adenoviruses based on HAdV-4. (A) Similarly to the HAdV-5-based constructs (upper panel), a recombinant HAdV-4 based bacmid was constructed (lower panel), which was flanked with ACT sequences (red, PAM is underlined) at both ITRs (here, the right ITR is shown, white letters). This sequence can be targeted by the universal sgRNA-Ex, like for the HAdV-5 based constructs (upper panel). Here also another sgRNA (sgRNA-Int4, blue, PAM is underlined) targeting the HAdV-4 ITRs (bold) can induce Cas9-mediated cleavage at the ITRs (blue triangles). (B) The rAd reconstitution efficiencies were determined after co-transfection of A549, SKOV-3, and 293A cells with pBWH-E4-ΔE3 with either pAR-gRNA-Cas9F-Amp expressing sgRNA-Ex (E4-Ex) or with pAR-Int4-Cas9F-Amp (E4-Int4, for 293A cells only). The primary rescue efficiencies were obtained as in . A549-Ex and SKOV-3-Ex were tested twice in technical duplicates, and error bars represent spread of results. E4-Ex and E4-Int4 were done three times in technical duplicates, and error bars represent standard deviation. Significance was calculated using unpaired t -test comparing E4-Ex and E4-Int4. ** p < 0.01.

Article Snippet: The expression cassette coding for the destabilized, human codon-optimized Cas9 fusion protein (DD-Cas9) was constructed on the basis of pDD-Cas9 [Addgene Plasmid #90086, a kind gift from Raffaella Sordella ( )] by inserting a glutamine codon instead of the first methionine codon of the Cas9 coding sequence.

Techniques: Recombinant, Construct, Sequencing, Cotransfection, Expressing, Standard Deviation

Journal: Frontiers in Microbiology

Article Title: Rescue of Recombinant Adenoviruses by CRISPR/Cas-Mediated in vivo Terminal Resolution

doi: 10.3389/fmicb.2022.854690

Figure Lengend Snippet: CRISPR-Cas-mediated cleavage in cells yielded efficient rescue of recombinant adenoviruses based on HAdV-5. (A) The ITRs on an existing rAd-plasmid were extended by artificial CRISPR/Cas9 target sequences ( ACT sequences , red), which were targeted by sgRNA-Ex (red line, PAM is underlined) inducing double-strand breaks 6–7 bp outside of the ITRs (indicated by the red triangles on the sgRNA targeting strand only). (B) Reconstitution efficiency of rAds in 293A cells after transfection of circular pBWH-C5-mChe (an ACT-flanked Ad5-bacmid) alone (cir5), a linearized rAd5 bacmid (lin5), a circular rAd5 bacmid carrying fusion ITRs (ITRf 5) or co-transfection of circular pBWH-C5-mChe with pAR-gRNA-Cas9F-Amp, a Cas9, and gRNA-Ex expressing helper plasmid for CRISPR/Cas-mediated terminal resolution (CTR 5). The appearing plaques were counted after seeding the transfectants into multiwell plates by observing the plates for 14 days after transfection. Statistical significance was determined using Welch ANOVA tests. (C) The rAd reconstitution efficiencies (as foci/μg DNA) in 293A cells of pBWH-C5-mChe-DD-Cas9, expressing conditional Cas9 (green bars) with co-expression of sgRNA-Ex, in the presence of stabilizer Shield-1 at the indicated concentrations are compared to the efficiency of CTR using Cas9F as for CTR 5 in (B) (red bar). The primary rescue efficiencies were obtained as in (B) . Significance was calculated using ordinary one-way ANOVA. * p < 0.05 and ** p < 0.01.

Article Snippet: The expression cassette coding for the destabilized, human codon-optimized Cas9 fusion protein (DD-Cas9) was constructed on the basis of pDD-Cas9 [Addgene Plasmid #90086, a kind gift from Raffaella Sordella ( )] by inserting a glutamine codon instead of the first methionine codon of the Cas9 coding sequence.

Techniques: CRISPR, Recombinant, Plasmid Preparation, Transfection, Cotransfection, Expressing

Journal: Cell Death & Disease

Article Title: Calcium overload induced mitochondrial and lysosomal dysfunction is regulated by Tousled-like kinase in a-synucleinopathy

doi: 10.1038/s41419-025-08213-8

Figure Lengend Snippet: A Schematic experimental design in panels ( B – E ), homozygous TLK2 KO mice (TLK2 flox/flox ; UBC-Cre ERT2/+ ) at 8–10 weeks-old were obtained by administration tamoxifen (with corn oil as a control) via intraperitoneal injection. One week later, these mice were injected with AAV9-CMV-human-α-synuclein or PBS in the SNc. One month after the injection, the mice were tested for behavioral alternation. B Western blot of the tissue extracts from the AAV-syn, AAV-syn+TLK2 CKO, and control mice ( n = 4 independent trials). Quantification of TLK2, TH, α-synuclein, P62 and LC3-II/LC3-I ratio level. C Immunostaining images of the TH neurons (red) in the SNc, nuclei were stained with DAPI (blue), α-synuclein were accompanied with GFP fluorescent protein (green) ( n = 4 independent trials). Scale bar, 10 µm. Quantification of the number of the TH and α-synuclein positive cells. D Immunostaining images of the P-S129-α-synuclein (red) in the SNc, nuclei were stained with DAPI (blue), α-synuclein were accompanied with GFP fluorescent protein (green) ( n = 4 independent trials). Scale bar, 10 μm. Quantification of the number of the P-S129-α-synuclein and α-synuclein positive cells. E Phos-tag western blot of the tissue extracts from the GluR1 Lc , α-synuclein overexpression and control mice. ALP was used for dephosphorylation of protein serine, threonine and tyrosine residues. Tubulin was used as a loading control ( n = 3 independent trials). Quantification of TLK2 phosphorylation level.

Article Snippet: Mouse: UBC-Cre ERT2/+ , Shanghai Model Organisms Center , N/A.

Techniques: Control, Injection, Western Blot, Immunostaining, Staining, Over Expression, De-Phosphorylation Assay, Phospho-proteomics